Top Breast Panel Multi-Tumor control slides

Multi–panel immunofluorescence evaluation of tumor infiltrating lymphocytes in triple adverse breast most cancers: Evolution of tumor immune profiles and affected person prognosis.

 

• The evolutionary adjustments in immune profiles of triple adverse breast most cancers (TNBC) aren’t properly understood, though it’s identified that immune checkpoint inhibitors have diminished exercise in closely pre-treated TNBC sufferers. This examine was designed to characterize immune profile adjustments of longitudinal tumor specimens by learning immune subsets of tumor infiltrating lymphocytes (TILs) in paired main and metastatic TNBC in a cohort of “poor end result” (relapsed inside 5 years) sufferers.

 

• Immune profiles of TNBCs in a cohort of “good end result” (no relapse inside 5 years) sufferers have been additionally analyzed. Immune subsets have been characterised for CD4, CD8, FOXP3, CD20, CD33, and PD1 utilizing immuno-fluorescence staining in stroma, tumor, and mixed stroma and tumor tissue. TIL subsets in “good end result” versus “poor end result” sufferers have been additionally analyzed. In contrast with main, metastatic TNBCs had considerably decrease TILs by hematoxylin and eosin (H&E) staining.

HAV HAV P2C recombinant antigen

• Stromal TILs (sTILs), however not tumoral TILs (tTILs) had considerably lowered cytotoxic CD8+ T cells (CTLs), PD1+ CTLs, and whole PD1+ TILs in metastatic in contrast with matched main TNBCs. Greater PD1+ CTLs, PD1+CD4+ helper T cells (PD1+TCONV) and all PD1+ T cells in sTILs, tTILs and whole stromal and tumor TILS (s+tTIL) have been all related to higher prognosis.

 

• In abstract, TIL subsets lower considerably in metastatic TNBCs in contrast with matched main. Hellogher PD1+ TILs are related to higher prognosis in early stage TNBCs. This discovering helps the appliance of immune checkpoint inhibitors early within the remedy of TNBCs

Tetranectin (CLEC3B) Antibody

Core Panel Multi-Tumor control slides
TS900-25	Innovex	Set of 25	EUR 485

Breast Panel Multi-Tumor control slides
TS901	Innovex	Set of 5	EUR 218

Breast Panel Multi-Tumor control slides
TS901-25	Innovex	Set of 25	EUR 485

HAV
DAG178	Creative Diagnostics	1 ml	EUR 629

Ivd/ Rat Ivd ELISA Kit
ELI-39421r	Lifescience Market	96 Tests	EUR 886

HAV HAV P2C recombinant antigen
00165-V-01mg	Virogen	0,1 mg	EUR 267.5
Category: Antigens, HAV, Ag
Description: HAV HAV P2C recombinant antigen a.a. 1121-1234.

HAV HAV P2C recombinant antigen
00165-V-1000ug	Virogen	1000 ug	EUR 1282.5
Category: Antigens, HAV, Ag
Description: HAV HAV P2C recombinant antigen a.a. 1121-1234.

IVD antibody
22140-100ul	SAB	100ul	EUR 390

IVD antibody
70R-18039	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal IVD antibody

IVD antibody
70R-13603	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal IVD antibody

IVD antibody
10R-4491	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal IVD antibody

IVD Antibody
DF12284	Affbiotech	200ul	EUR 304
Description: IVD antibody detects endogenous levels of IVD.

IVD Antibody
1-CSB-PA011921GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

IVD Antibody
1-CSB-PA011921LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000

IVD siRNA
20-abx902738	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IVD siRNA
20-abx920988	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IVD siRNA
20-abx920989	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-IVD
YF-PA12811	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to IVD

anti-IVD
YF-PA12812	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to IVD

HAV VP1
DAG1443	Creative Diagnostics	100 µg	EUR 645

HAV VP3
DAG1450	Creative Diagnostics	100 µg	EUR 645

HAV Protein
abx069838-1ml	Abbexa	1 ml	EUR 314
Shipped within 5-10 working days.

HAV Protein
abx069839-1ml	Abbexa	1 ml	EUR 982
Shipped within 5-10 working days.

HAV Antigen
E61H00101	EnoGene	1mg	EUR 611

Bordetella bronchiseptica proteins (inactivated vaccine for dog) for ELISA
BBV15-N-100	Alpha Diagnostics	100 ug	EUR 286

IVD Polyclonal Antibody
28898-100ul	SAB	100ul	EUR 252

IVD Polyclonal Antibody
28898-50ul	SAB	50ul	EUR 187

IVD Rabbit pAb
A15281-100ul	Abclonal	100 ul	EUR 308

IVD Rabbit pAb
A15281-200ul	Abclonal	200 ul	EUR 459

IVD Rabbit pAb
A15281-20ul	Abclonal	20 ul	EUR 183

IVD Rabbit pAb
A15281-50ul	Abclonal	50 ul	EUR 223

Human IVD Antibody
33170-05111	AssayPro	150 ug	EUR 261

IVD Blocking Peptide
DF12284-BP	Affbiotech	1mg	EUR 195

IVD cloning plasmid
CSB-CL011921HU-10ug	Cusabio	10ug	EUR 465
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1272 Sequence: atggcgactgcgactcggctgctggggtgtcgtgtggcgagctggaggctgcggccgccgcttgccggcttcgtttcccagcgggcccactcgcttttgcccgtggacgatgcaatcaatgggctaagcgaggagcagaggcagcttcgtcagaccatggctaagttccttcagg Show more
Description: A cloning plasmid for the IVD gene.

anti- IVD antibody
FNab04426	FN Test	100µg	EUR 505.25
Immunogen: isovaleryl Coenzyme A dehydrogenase Uniprot ID: P26440 Gene ID: 3712 Research Area: Metabolism
Description: Antibody raised against IVD

anti- IVD antibody
FNab04427	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:1000-1:6000 IHC: 1:20-1:200 IF: 1:10-1:100 Immunogen: isovaleryl Coenzyme A dehydrogenase Uniprot ID: P26440 Gene ID: 3712 Research Area: Metabolism
Description: Antibody raised against IVD

Anti-IVD antibody
PAab04426	Lifescience Market	100 ug	EUR 355

Anti-IVD antibody
STJ117476	St John's Laboratory	100 µl	EUR 277
Description: Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

IVD, Human Recombinant
P1577-100	Biovision	100 µg	EUR 510

IVD, Human Recombinant
P1577-20	Biovision	20 µg	EUR 156

Saponin Vaccine Adjuvant
VAdv-Ly0009	Creative Biolabs	1 g	EUR 1095
Description: Saponin Vaccine Adjuvant, plant-based vaccine adjuvant.

HAV VP3 antibody
10R-10488	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal HAV VP3 antibody

HAV VP3 antibody
10R-10489	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal HAV VP3 antibody

HAV VP1 antibody
10R-10520	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal HAV VP1 antibody

HAV VP1 antibody
10R-10521	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal HAV VP1 antibody

HAV VP1 antibody
10R-10522	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal HAV VP1 antibody

HAV P2C-P3A
DAG1448	Creative Diagnostics	100 µg	EUR 645

HAV VP2-VP4
DAG1451	Creative Diagnostics	100 µg	EUR 645

HAV VP3 Antibody
abx018272-100ug	Abbexa	100 ug	EUR 384
Shipped within 5-10 working days.

HAV VP3 Antibody
abx018273-100ug	Abbexa	100 ug	EUR 384
Shipped within 5-10 working days.

HAV VP1 Antibody
abx018304-100ug	Abbexa	100 ug	EUR 384
Shipped within 5-10 working days.

HAV VP1 Antibody
abx018305-100ug	Abbexa	100 ug	EUR 384
Shipped within 5-10 working days.

HAV VP1 Antibody
abx018306-100ug	Abbexa	100 ug	EUR 384
Shipped within 5-10 working days.

HAV P3C Protein
abx060523-1mg	Abbexa	1 mg	EUR 1511
Shipped within 5-10 working days.

HAV VP1 Protein
abx060524-1mg	Abbexa	1 mg	EUR 1525
Shipped within 5-10 working days.

HAV VP3 Protein
abx060526-1mg	Abbexa	1 mg	EUR 1525
Shipped within 5-10 working days.

HAV monoclonal antibody
VAnt-Lsx001-1mg	Creative Biolabs	1 mg	EUR 2577
Description: HAV, Monoclonal Antibody; contains a high concentration of viral antibody.

HAV monoclonal antibody
VAnt-Lsx001-5mg	Creative Biolabs	5mg	EUR 4970
Description: HAV, Monoclonal Antibody; contains a high concentration of viral antibody.

 

 

Detection of Germline Mutations in Breast Most cancers Sufferers with Medical Options of Hereditary Most cancers Syndrome Utilizing a Multi-Gene Panel Take a look at.

 

Hereditary most cancers syndrome signifies that inherited genetic mutations can improve an individual’s danger of creating most cancers.

Tetranectin Polyclonal Antibody

 

We assessed the frequency of germline mutations utilizing an NGS-based multiple-gene panel containing 64-cancer predisposing genes in Korean breast most cancers sufferers with medical options of hereditary breast and ovarian most cancers syndrome (HBOC).A complete of 64 genes related to hereditary most cancers syndrome have been chosen for improvement of an NGS-based multi-gene panel.

Human Tetranectin (CLEC3B) ELISA Package

Focused sequencing utilizing the multi-gene panel was carried out to establish germline mutations in 496 breast most cancers sufferers with medical options of HBOC who underwent breast most cancers surgical procedure between January 2002 and December 2017.Of 496 sufferers, 95 sufferers (19.2%) have been discovered to have 48 deleterious germline mutations in 16 most cancers susceptibility genes.

anti-Tetranectin
YF-PA24864	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Tetranectin

Anti-Tetranectin Antibody
A08805	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for Tetranectin Antibody (CLEC3B) detection.tested for IHC in Human, Mouse.

Anti-Tetranectin antibody
STJ98805	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Tetranectin.

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 349

Tetranectin Antibody
49915-100ul	SAB	100ul	EUR 333

Tetranectin Antibody
49915-50ul	SAB	50ul	EUR 239

Recombinant Human Tetranectin Protein
RP00991	Abclonal	10 μg	EUR 155

Tetranectin Polyclonal Antibody
46862-100ul	SAB	100ul	EUR 252

Tetranectin Polyclonal Antibody
46862-50ul	SAB	50ul	EUR 187

Tetranectin (CLEC3B) Antibody
20-abx004912	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Tetranectin (CLEC3B) Antibody
20-abx125686	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Tetranectin (CLEC3B) Antibody
abx145920-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Tetranectin Conjugated Antibody
C49915	SAB	100ul	EUR 397

Tetranectin (CLEC3B) Antibody
20-abx320279	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Tetranectin (CLEC3B) Antibody
20-abx225113	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Tetranectin (CLEC3B) Antibody
abx231752-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Tetranectin Rabbit mAb
A4387-100ul	Abclonal	100 ul	EUR 410

Tetranectin Rabbit mAb
A4387-200ul	Abclonal	200 ul	EUR 571

Tetranectin Rabbit mAb
A4387-20ul	Abclonal	20 ul	EUR 221

Tetranectin Rabbit mAb
A4387-50ul	Abclonal	50 ul	EUR 287

Tetranectin Polyclonal Antibody
ABP60656-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human Tetranectin protein at amino acid sequence of 11-60 Applications tips:
Description: A polyclonal antibody for detection of Tetranectin from Human, Mouse. This Tetranectin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Tetranectin protein at amino acid sequence of 11-60

Tetranectin Polyclonal Antibody
ABP60656-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human Tetranectin protein at amino acid sequence of 11-60 Applications tips:
Description: A polyclonal antibody for detection of Tetranectin from Human, Mouse. This Tetranectin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Tetranectin protein at amino acid sequence of 11-60

Tetranectin Polyclonal Antibody
ABP60656-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human Tetranectin protein at amino acid sequence of 11-60 Applications tips:
Description: A polyclonal antibody for detection of Tetranectin from Human, Mouse. This Tetranectin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Tetranectin protein at amino acid sequence of 11-60

Tetranectin Polyclonal Antibody
ES8742-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Tetranectin from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

Tetranectin Polyclonal Antibody
ES8742-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Tetranectin from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

Human CLEC3B/ Tetranectin ELISA Kit
E0507Hu	Sunlong	1 Kit	EUR 571

Human Tetranectin(CLEC3B) ELISA kit
E01T0030-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tetranectin(CLEC3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tetranectin(CLEC3B) ELISA kit
E01T0030-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tetranectin(CLEC3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tetranectin(CLEC3B) ELISA kit
E01T0030-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tetranectin(CLEC3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tetranectin (CLEC3B) ELISA Kit
abx252170-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Human Tetranectin
EK3337	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Tetranectin in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Tetranectin/ CLEC3B ELISA Kit
ELA-E14924h	Lifescience Market	96 Tests	EUR 824

Human CLEC3B(Tetranectin) ELISA Kit
EH0279	FN Test	96T	EUR 567.6
Detection range: 0.78-50 ng/ml Uniprot ID: P05452 Alias: CLEC3B/Tetranectin/TETN/TNA/C-type lectin domain family 3 member B/C-type lectin domain family 3, member B
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human Tetranectin, CLEC3B ELISA KIT
ELI-04595h	Lifescience Market	96 Tests	EUR 824

Human Tetranectin(CLEC3B) ELISA kit
CSB-EL005531HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tetranectin (CLEC3B) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tetranectin(CLEC3B) ELISA kit
1-CSB-EL005531HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tetranectin(CLEC3B) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human CellExp? CLEC3B / Tetranectin, Human recombinant
P1058-10	Biovision		EUR 153

Human CellExp? CLEC3B / Tetranectin, Human recombinant
P1058-50	Biovision		EUR 501

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280

Tetranectin Polyclonal Conjugated Antibody
C46862	SAB	100ul	EUR 397

Human Tetranectin/CLEC3B PicoKine ELISA Kit
EK1253	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human Tetranectin in cell culture supernates and serum.

Recombinant Human CLEC3B/Tetranectin (C-6His)
C453-10ug	Novoprotein	10ug	EUR 131
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human CLEC3B/Tetranectin (C-6His)
C453-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human CLEC3B/Tetranectin (C-6His)
C453-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human CLEC3B/Tetranectin (C-6His)
C453-50ug	Novoprotein	50ug	EUR 273
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Tetranectin/CLEC3B ELISA Kit (Human) (OKBB00562)
OKBB00562	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Tetranectin, also called TNA, is a protein that in humans is encoded by the CLEC3B gene. It is mapped to 3p21.31. Tetranectin, a tetrameric protein isolated from human plasma, has 4 identical and noncovalently bound polypeptide chains, each of 181 amino acid residues. It has a specific binding affinity for sulfated polysaccharides and the kringle 4 of plasminogen. The plasma concentration of tetranectin is reduced in patients with various malignancies. Tetranectin is a plasminogen-binding protein that is induced during the mineralization phase of osteogenesis. Thus, tetranectin is a candidate gene for human disorders affecting bone and connective tissue.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

Rabbit Tetranectin(CLEC3B) ELISA kit
E04T0030-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tetranectin(CLEC3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tetranectin(CLEC3B) ELISA kit
E04T0030-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tetranectin(CLEC3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tetranectin(CLEC3B) ELISA kit
E04T0030-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tetranectin(CLEC3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tetranectin(CLEC3B) ELISA kit
E02T0030-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Tetranectin(CLEC3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tetranectin(CLEC3B) ELISA kit
E02T0030-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Tetranectin(CLEC3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tetranectin(CLEC3B) ELISA kit
E02T0030-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Tetranectin(CLEC3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

The deleterious mutations have been present in 39 of 250 sufferers (15.6%) who had breast most cancers and one other main most cancers, 38 of 169 sufferers (22.5%) who had a household historical past of breast most cancers (≥ 2 family members), 16 of 57 sufferers (28.1%) who had bilateral breast most cancers, and 29 of 84 sufferers (34.5%) who have been recognized with breast most cancers at youthful than 40 years of age.

Human CellExp? CLEC3B / Tetranectin, Human recombinant

Of the 95 sufferers with deleterious mutations, 60 sufferers (63.2%) had BRCA1/2 mutations and 38 sufferers (40.0%) had non-BRCA1/2 mutations. We detected 2 novel deleterious mutations in BRCA2 and MLH1.NGS-based multiple-gene panel testing improved the detection charges of deleterious mutations and supplied a cheap most cancers danger evaluation.