Top Breast Panel Multi-Tumor control slides

Multipanel immunofluorescence evaluation of tumor infiltrating lymphocytes in triple adverse breast most cancers: Evolution of tumor immune profiles and affected person prognosis.

 

  • The evolutionary adjustments in immune profiles of triple adverse breast most cancers (TNBC) aren’t properly understood, though it’s identified that immune checkpoint inhibitors have diminished exercise in closely pre-treated TNBC sufferers. This examine was designed to characterize immune profile adjustments of longitudinal tumor specimens by learning immune subsets of tumor infiltrating lymphocytes (TILs) in paired main and metastatic TNBC in a cohort of “poor end result” (relapsed inside 5 years) sufferers.

 

  • Immune profiles of TNBCs in a cohort of “good end result” (no relapse inside 5 years) sufferers have been additionally analyzed. Immune subsets have been characterised for CD4, CD8, FOXP3, CD20, CD33, and PD1 utilizing immuno-fluorescence staining in stroma, tumor, and mixed stroma and tumor tissue. TIL subsets in “good end result” versus “poor end result” sufferers have been additionally analyzed. In contrast with main, metastatic TNBCs had considerably decrease TILs by hematoxylin and eosin (H&E) staining.

HAV HAV P2C recombinant antigen

  • Stromal TILs (sTILs), however not tumoral TILs (tTILs) had considerably lowered cytotoxic CD8+ T cells (CTLs), PD1+ CTLs, and whole PD1+ TILs in metastatic in contrast with matched main TNBCs. Greater PD1+ CTLs, PD1+CD4+ helper T cells (PD1+TCONV) and all PD1+ T cells in sTILs, tTILs and whole stromal and tumor TILS (s+tTIL) have been all related to higher prognosis.

 

  • In abstract, TIL subsets lower considerably in metastatic TNBCs in contrast with matched main. Hellogher PD1+ TILs are related to higher prognosis in early stage TNBCs. This discovering helps the appliance of immune checkpoint inhibitors early within the remedy of TNBCs

Tetranectin (CLEC3B) Antibody

Core Panel Multi-Tumor control slides
TS900-25 Set of 25
EUR 485
Breast Panel Multi-Tumor control slides
TS901 Set of 5
EUR 218
Breast Panel Multi-Tumor control slides
TS901-25 Set of 25
EUR 485
HAV
DAG178 1 ml
EUR 629
Ivd/ Rat Ivd ELISA Kit
ELI-39421r 96 Tests
EUR 886
HAV HAV P2C recombinant antigen
00165-V-01mg 0,1 mg
EUR 267.5
  • Category: Antigens, HAV, Ag
Description: HAV HAV P2C recombinant antigen a.a. 1121-1234.
HAV HAV P2C recombinant antigen
00165-V-1000ug 1000 ug
EUR 1282.5
  • Category: Antigens, HAV, Ag
Description: HAV HAV P2C recombinant antigen a.a. 1121-1234.
IVD antibody
22140-100ul 100ul
EUR 390
IVD antibody
70R-18039 50 ul
EUR 435
Description: Rabbit polyclonal IVD antibody
IVD antibody
70R-13603 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal IVD antibody
IVD antibody
10R-4491 100 ul
EUR 691
Description: Mouse monoclonal IVD antibody
IVD Antibody
DF12284 200ul
EUR 304
Description: IVD antibody detects endogenous levels of IVD.
IVD Antibody
1-CSB-PA011921GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
IVD Antibody
1-CSB-PA011921LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000
IVD siRNA
20-abx902738
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
IVD siRNA
20-abx920988
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
IVD siRNA
20-abx920989
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-IVD
YF-PA12811 50 ug
EUR 363
Description: Mouse polyclonal to IVD
anti-IVD
YF-PA12812 100 ug
EUR 403
Description: Rabbit polyclonal to IVD
HAV VP1
DAG1443 100 µg
EUR 645
HAV VP3
DAG1450 100 µg
EUR 645
HAV Protein
abx069838-1ml 1 ml
EUR 314
  • Shipped within 5-10 working days.
HAV Protein
abx069839-1ml 1 ml
EUR 982
  • Shipped within 5-10 working days.
HAV Antigen
E61H00101 1mg
EUR 611
Bordetella bronchiseptica proteins (inactivated vaccine for dog) for ELISA
BBV15-N-100 100 ug
EUR 286
IVD Polyclonal Antibody
28898-100ul 100ul
EUR 252
IVD Polyclonal Antibody
28898-50ul 50ul
EUR 187
IVD Rabbit pAb
A15281-100ul 100 ul
EUR 308
IVD Rabbit pAb
A15281-200ul 200 ul
EUR 459
IVD Rabbit pAb
A15281-20ul 20 ul
EUR 183
IVD Rabbit pAb
A15281-50ul 50 ul
EUR 223
Human IVD Antibody
33170-05111 150 ug
EUR 261
IVD Blocking Peptide
DF12284-BP 1mg
EUR 195
IVD cloning plasmid
CSB-CL011921HU-10ug 10ug
EUR 465
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1272
  • Sequence: atggcgactgcgactcggctgctggggtgtcgtgtggcgagctggaggctgcggccgccgcttgccggcttcgtttcccagcgggcccactcgcttttgcccgtggacgatgcaatcaatgggctaagcgaggagcagaggcagcttcgtcagaccatggctaagttccttcagg
  • Show more
Description: A cloning plasmid for the IVD gene.
anti- IVD antibody
FNab04426 100µg
EUR 505.25
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD
anti- IVD antibody
FNab04427 100µg
EUR 585
  • Recommended dilution: WB: 1:1000-1:6000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD
Anti-IVD antibody
PAab04426 100 ug
EUR 355
Anti-IVD antibody
STJ117476 100 µl
EUR 277
Description: Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.
IVD, Human Recombinant
P1577-100 100 µg
EUR 510
IVD, Human Recombinant
P1577-20 20 µg
EUR 156
Saponin Vaccine Adjuvant
VAdv-Ly0009 1 g
EUR 1095
Description: Saponin Vaccine Adjuvant, plant-based vaccine adjuvant.
HAV VP3 antibody
10R-10488 100 ug
EUR 435
Description: Mouse monoclonal HAV VP3 antibody
HAV VP3 antibody
10R-10489 100 ug
EUR 435
Description: Mouse monoclonal HAV VP3 antibody
HAV VP1 antibody
10R-10520 100 ug
EUR 435
Description: Mouse monoclonal HAV VP1 antibody
HAV VP1 antibody
10R-10521 100 ug
EUR 435
Description: Mouse monoclonal HAV VP1 antibody
HAV VP1 antibody
10R-10522 100 ug
EUR 435
Description: Mouse monoclonal HAV VP1 antibody
HAV P2C-P3A
DAG1448 100 µg
EUR 645
HAV VP2-VP4
DAG1451 100 µg
EUR 645
HAV VP3 Antibody
abx018272-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.
HAV VP3 Antibody
abx018273-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.
HAV VP1 Antibody
abx018304-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.
HAV VP1 Antibody
abx018305-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.
HAV VP1 Antibody
abx018306-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.
HAV P3C Protein
abx060523-1mg 1 mg
EUR 1511
  • Shipped within 5-10 working days.
HAV VP1 Protein
abx060524-1mg 1 mg
EUR 1525
  • Shipped within 5-10 working days.
HAV VP3 Protein
abx060526-1mg 1 mg
EUR 1525
  • Shipped within 5-10 working days.
HAV monoclonal antibody
VAnt-Lsx001-1mg 1 mg
EUR 2577
Description: HAV, Monoclonal Antibody; contains a high concentration of viral antibody.
HAV monoclonal antibody
VAnt-Lsx001-5mg 5mg
EUR 4970
Description: HAV, Monoclonal Antibody; contains a high concentration of viral antibody.

 

 

Detection of Germline Mutations in Breast Most cancers Sufferers with Medical Options of Hereditary Most cancers Syndrome Utilizing a Multi-Gene Panel Take a look at.

 

Hereditary most cancers syndrome signifies that inherited genetic mutations can improve an individual’s danger of creating most cancers.

Tetranectin Polyclonal Antibody

 

We assessed the frequency of germline mutations utilizing an NGS-based multiple-gene panel containing 64-cancer predisposing genes in Korean breast most cancers sufferers with medical options of hereditary breast and ovarian most cancers syndrome (HBOC).A complete of 64 genes related to hereditary most cancers syndrome have been chosen for improvement of an NGS-based multi-gene panel.

Human Tetranectin (CLEC3B) ELISA Package

Focused sequencing utilizing the multi-gene panel was carried out to establish germline mutations in 496 breast most cancers sufferers with medical options of HBOC who underwent breast most cancers surgical procedure between January 2002 and December 2017.Of 496 sufferers, 95 sufferers (19.2%) have been discovered to have 48 deleterious germline mutations in 16 most cancers susceptibility genes.

anti-Tetranectin

YF-PA24864 50 ul
EUR 334
Description: Mouse polyclonal to Tetranectin

Anti-Tetranectin Antibody

A08805 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Tetranectin Antibody (CLEC3B) detection.tested for IHC in Human, Mouse.

Anti-Tetranectin antibody

STJ98805 200 µl
EUR 197
Description: Rabbit polyclonal to Tetranectin.

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Tetranectin Antibody

49915-100ul 100ul
EUR 333

Tetranectin Antibody

49915-50ul 50ul
EUR 239

Recombinant Human Tetranectin Protein

RP00991 10 μg
EUR 155

Tetranectin Polyclonal Antibody

46862-100ul 100ul
EUR 252

Tetranectin Polyclonal Antibody

46862-50ul 50ul
EUR 187

Tetranectin (CLEC3B) Antibody

20-abx004912
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tetranectin (CLEC3B) Antibody

20-abx125686
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tetranectin (CLEC3B) Antibody

abx145920-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Tetranectin Conjugated Antibody

C49915 100ul
EUR 397

Tetranectin (CLEC3B) Antibody

20-abx320279
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tetranectin (CLEC3B) Antibody

20-abx225113
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tetranectin (CLEC3B) Antibody

abx231752-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Tetranectin Rabbit mAb

A4387-100ul 100 ul
EUR 410

Tetranectin Rabbit mAb

A4387-200ul 200 ul
EUR 571

Tetranectin Rabbit mAb

A4387-20ul 20 ul
EUR 221

Tetranectin Rabbit mAb

A4387-50ul 50 ul
EUR 287

Tetranectin Polyclonal Antibody

ABP60656-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human Tetranectin protein at amino acid sequence of 11-60
  • Applications tips:
Description: A polyclonal antibody for detection of Tetranectin from Human, Mouse. This Tetranectin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Tetranectin protein at amino acid sequence of 11-60

Tetranectin Polyclonal Antibody

ABP60656-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human Tetranectin protein at amino acid sequence of 11-60
  • Applications tips:
Description: A polyclonal antibody for detection of Tetranectin from Human, Mouse. This Tetranectin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Tetranectin protein at amino acid sequence of 11-60

Tetranectin Polyclonal Antibody

ABP60656-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human Tetranectin protein at amino acid sequence of 11-60
  • Applications tips:
Description: A polyclonal antibody for detection of Tetranectin from Human, Mouse. This Tetranectin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Tetranectin protein at amino acid sequence of 11-60

Tetranectin Polyclonal Antibody

ES8742-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Tetranectin from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

Tetranectin Polyclonal Antibody

ES8742-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Tetranectin from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

Human CLEC3B/ Tetranectin ELISA Kit

E0507Hu 1 Kit
EUR 571

Human Tetranectin(CLEC3B) ELISA kit

E01T0030-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tetranectin(CLEC3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tetranectin(CLEC3B) ELISA kit

E01T0030-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tetranectin(CLEC3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tetranectin(CLEC3B) ELISA kit

E01T0030-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tetranectin(CLEC3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tetranectin (CLEC3B) ELISA Kit

abx252170-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human Tetranectin

EK3337 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Tetranectin in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Tetranectin/ CLEC3B ELISA Kit

ELA-E14924h 96 Tests
EUR 824

Human CLEC3B(Tetranectin) ELISA Kit

EH0279 96T
EUR 567.6
  • Detection range: 0.78-50 ng/ml
  • Uniprot ID: P05452
  • Alias: CLEC3B/Tetranectin/TETN/TNA/C-type lectin domain family 3 member B/C-type lectin domain family 3, member B
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human Tetranectin, CLEC3B ELISA KIT

ELI-04595h 96 Tests
EUR 824

Human Tetranectin(CLEC3B) ELISA kit

CSB-EL005531HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tetranectin (CLEC3B) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tetranectin(CLEC3B) ELISA kit

1-CSB-EL005531HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tetranectin(CLEC3B) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human CellExp? CLEC3B / Tetranectin, Human recombinant

P1058-10
EUR 153

Human CellExp? CLEC3B / Tetranectin, Human recombinant

P1058-50
EUR 501

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Tetranectin Polyclonal Conjugated Antibody

C46862 100ul
EUR 397

Human Tetranectin/CLEC3B PicoKine ELISA Kit

EK1253 96 wells
EUR 425
Description: For quantitative detection of human Tetranectin in cell culture supernates and serum.

Recombinant Human CLEC3B/Tetranectin (C-6His)

C453-10ug 10ug
EUR 131
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human CLEC3B/Tetranectin (C-6His)

C453-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human CLEC3B/Tetranectin (C-6His)

C453-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human CLEC3B/Tetranectin (C-6His)

C453-50ug 50ug
EUR 273
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Tetranectin/CLEC3B ELISA Kit (Human) (OKBB00562)

OKBB00562 96 Wells
EUR 505
Description: Description of target: Tetranectin, also called TNA, is a protein that in humans is encoded by the CLEC3B gene. It is mapped to 3p21.31. Tetranectin, a tetrameric protein isolated from human plasma, has 4 identical and noncovalently bound polypeptide chains, each of 181 amino acid residues. It has a specific binding affinity for sulfated polysaccharides and the kringle 4 of plasminogen. The plasma concentration of tetranectin is reduced in patients with various malignancies. Tetranectin is a plasminogen-binding protein that is induced during the mineralization phase of osteogenesis. Thus, tetranectin is a candidate gene for human disorders affecting bone and connective tissue.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

Rabbit Tetranectin(CLEC3B) ELISA kit

E04T0030-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tetranectin(CLEC3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tetranectin(CLEC3B) ELISA kit

E04T0030-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tetranectin(CLEC3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tetranectin(CLEC3B) ELISA kit

E04T0030-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tetranectin(CLEC3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tetranectin(CLEC3B) ELISA kit

E02T0030-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Tetranectin(CLEC3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tetranectin(CLEC3B) ELISA kit

E02T0030-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Tetranectin(CLEC3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tetranectin(CLEC3B) ELISA kit

E02T0030-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Tetranectin(CLEC3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

The deleterious mutations have been present in 39 of 250 sufferers (15.6%) who had breast most cancers and one other main most cancers, 38 of 169 sufferers (22.5%) who had a household historical past of breast most cancers (≥ 2 family members), 16 of 57 sufferers (28.1%) who had bilateral breast most cancers, and 29 of 84 sufferers (34.5%) who have been recognized with breast most cancers at youthful than 40 years of age.

Human CellExp? CLEC3B / Tetranectin, Human recombinant

Of the 95 sufferers with deleterious mutations, 60 sufferers (63.2%) had BRCA1/2 mutations and 38 sufferers (40.0%) had non-BRCA1/2 mutations. We detected 2 novel deleterious mutations in BRCA2 and MLH1.NGS-based multiple-gene panel testing improved the detection charges of deleterious mutations and supplied a cheap most cancers danger evaluation.